Jatropha Genome Database

JcCA0081161.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0081161.10 - phase: 1 /pseudo/partial
         (269 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30024.m001747 conserved hypothetical protein                          111   2e-24

>30024.m001747 conserved hypothetical protein
          Length = 729

 Score =  111 bits (56), Expect = 2e-24
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                       
Query: 84  gaagccagggataagaatatagcaggcaatgctgaagcccccttcttgcttggaagagtg 143
           ||||||||||||||||||||| |||||||||||||| |||||||||||||||  ||||||
Sbjct: 541 gaagccagggataagaatataacaggcaatgctgaaacccccttcttgcttgccagagtg 600

                                           
Query: 144 gatgaaataattggaggtgcctcattggcatc 175
            ||||| ||| |||||||| |||| |||||||
Sbjct: 601 aatgaagtaactggaggtgtctcactggcatc 632