Jatropha Genome Database

JcCA0080721.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0080721.30 - phase: 0 /pseudo/partial
         (332 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008952 conserved hypothetical protein                           72   2e-12

>30174.m008952 conserved hypothetical protein
          Length = 354

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 251 cattgcagctgcagcagcttatgctcttggatggacgcttaggaatgtagctcacttgga 310
           |||||| ||| | ||||||||| ||||||||||||||||||||||||| || ||| | ||
Sbjct: 270 cattgctgctactgcagcttattctcttggatggacgcttaggaatgtcgcccacctaga 329

                           
Query: 311 agacactgaaaatgct 326
           |||||| | |||||||
Sbjct: 330 agacaccggaaatgct 345