Jatropha Genome Database

JcCA0080591.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0080591.30 - phase: 0 
         (804 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30169.m006272 conserved hypothetical protein                          155   5e-37

>30169.m006272 conserved hypothetical protein
          Length = 1809

 Score =  155 bits (78), Expect = 5e-37
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                        
Query: 330  gagaaaagatcaaggaatggttgatgtatggttagaggaggagcttgattttctttggat 389
            |||||||||| |||  ||||| || || ||||||||||||||||||||||  ||||||||
Sbjct: 1428 gagaaaagatgaagccatggtagacgtttggttagaggaggagcttgattcactttggat 1487

                                                                        
Query: 390  tggtgtccgcagacatgggcaaggaaattgggaggccatgctcagagacccctcactttc 449
            ||||||||||||||||||||  |||||||||||   |||||| ||||||||||| || ||
Sbjct: 1488 tggtgtccgcagacatgggcctggaaattgggaacgcatgctaagagacccctcgctgtc 1547

                                                                        
Query: 450  tttctccaagcataaaaccatagaagatctatcgcgacggtgggagaaagaaaggcttaa 509
            |||||||||||||||||| || || ||||| |||| | ||||| |||| || || |||| 
Sbjct: 1548 tttctccaagcataaaactattgaggatctgtcgcaaaggtggaagaaggagagacttag 1607

                  
Query: 510  aatctt 515
            ||||||
Sbjct: 1608 aatctt 1613



 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 638  atcagctgccttcatgtggggaaaagaaagttcagcaaaaccttcttcttggtggattaa 697
            |||||||||| ||| || ||| ||| | || |||||  |||||||| |||||||||||||
Sbjct: 1643 atcagctgccatcaagtaggggaaatagagctcagccgaaccttctccttggtggattaa 1702

                    
Query: 698  ttaacatt 705
            ||||||||
Sbjct: 1703 ttaacatt 1710