Jatropha Genome Database

JcCA0079711.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0079711.20 - phase: 2 /partial
         (391 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29598.m000471 calcium ion binding protein, putative                   135   2e-31

>29598.m000471 calcium ion binding protein, putative
          Length = 984

 Score =  135 bits (68), Expect = 2e-31
 Identities = 170/204 (83%)
 Strand = Plus / Plus

                                                                       
Query: 188 gaggaaaatgggaaagaattaggtttgccaccatcagaagccaacgaagcagttatgctt 247
           ||||||||||| ||||| || || |||||| ||||||||||||||||||||||  | || 
Sbjct: 778 gaggaaaatggaaaagagttgggcttgccagcatcagaagccaacgaagcagtggttctc 837

                                                                       
Query: 248 ctctacgatgcagtatttgctgaagtagagtgcggaaaatgcattgcagagtcagaggat 307
           ||||||||||| |||||  ||||  || ||   | ||||||   |||||| |||||||||
Sbjct: 838 ctctacgatgcggtattctctgatataaagaatgaaaaatgtgctgcagaatcagaggat 897

                                                                       
Query: 308 gaatttagggaactagtcaaggaaatcctcaagaattttgcgcagcagcttcaggctaat 367
           ||||||| |||||| || |||||||||||  |||| |||||  |||||||| |||| |||
Sbjct: 898 gaatttaaggaacttgtgaaggaaatccttgagaaatttgcagagcagcttgaggccaat 957

                                   
Query: 368 cctgtctactgtgatcttgacaat 391
           |||||||| |||||||||||||||
Sbjct: 958 cctgtctattgtgatcttgacaat 981