Jatropha Genome Database
- JcCA0078491.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0078491.10 - phase: 0 /partial
(312 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27985.m000861 conserved hypothetical protein 100 9e-21
>27985.m000861 conserved hypothetical protein
Length = 813
Score = 99.6 bits (50), Expect = 9e-21
Identities = 140/170 (82%)
Strand = Plus / Plus
Query: 143 ggtgcagaaagaacacaactttacccgccaggaagctcctaattcgagctgccaggactg 202
|||||||||||| || | |||||||| | || ||||| || || ||||||| || ||||
Sbjct: 146 ggtgcagaaagatcaaagctttacccactagaaagctgatagttagagctgctagaactg 205
Query: 203 agtctcaaggtgtgttcttaggcttcagaccgcccaattttgagcttccagagcctctta 262
|||| |||||||| ||||| |||||| ||||| |||||||| | | ||||||| | |
Sbjct: 206 agtcacaaggtgtcaatttaggattcagagcgccccattttgagttgcaagagcctttaa 265
Query: 263 ctgggaaaacgtggaaactggacgattttgagtcgtatcctgctttattg 312
||||||||| ||| |||| || |||||||||||||||||||||||||||
Sbjct: 266 ctgggaaaatttgggaacttgaagattttgagtcgtatcctgctttattg 315