Jatropha Genome Database

JcCA0077581.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0077581.10 + phase: 0 
         (528 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30204.m001765 conserved hypothetical protein                           54   9e-07

>30204.m001765 conserved hypothetical protein
          Length = 720

 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 74  aatccaccaccttaggtgttcgtacaagagctaaaaccctagc 116
           |||| |||||||||||||| || ||| ||||||||||||||||
Sbjct: 56  aatctaccaccttaggtgtccggacacgagctaaaaccctagc 98