Jatropha Genome Database

JcCA0077401.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0077401.10 + phase: 0 
         (345 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29912.m005305 conserved hypothetical protein                          337   3e-92

>29912.m005305 conserved hypothetical protein
          Length = 429

 Score =  337 bits (170), Expect = 3e-92
 Identities = 281/318 (88%)
 Strand = Plus / Plus

                                                                       
Query: 2   tggtgaaatcagcctctgataagcacatagatcttctccggccatctgcacgatactatt 61
           |||||||||| || ||||| ||||| || ||||||||| |||||||||| || |||||||
Sbjct: 56  tggtgaaatctgcatctgacaagcatattgatcttctcaggccatctgctcggtactatt 115

                                                                       
Query: 62  cagcatctaaagggcaagccctagatgctgcagaccgtgaaaagggcaagtatacacttc 121
           | || || ||||||||||||| |||||  ||||| || |||||||| |||||||| ||||
Sbjct: 116 cggcttccaaagggcaagccccagatggcgcagatcgagaaaaggggaagtatacccttc 175

                                                                       
Query: 122 ttagagatcctgaggaatttcaagttgggatgtatgacaaaccacttccatgctttggct 181
           |||||||| ||||||| || ||| | ||||| ||||||||||| ||||| ||||| || |
Sbjct: 176 ttagagattctgaggacttccaaatcgggatttatgacaaaccccttccctgcttcggtt 235

                                                                       
Query: 182 gtggtgtaggatggttttcttttcttttaggatttgtgttcccattgatgtggtattatg 241
           ||||||||||||||||||||||||||||||| || | |||||||||||||||||| ||||
Sbjct: 236 gtggtgtaggatggttttcttttcttttagggttcgcgttcccattgatgtggtactatg 295

                                                                       
Query: 242 ccacaattctttactttggaaattattaccgaaaggatcctagggagcgagcaggcctgg 301
           ||||| ||||||||||||| || |||||||| |||||||||||||||||||||||||| |
Sbjct: 296 ccacatttctttactttgggaactattaccgcaaggatcctagggagcgagcaggccttg 355

                             
Query: 302 ctgcagctgccattgctg 319
           ||||||||||||||||||
Sbjct: 356 ctgcagctgccattgctg 373