Jatropha Genome Database

JcCA0077011.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0077011.20 - phase: 0 /pseudo/partial
         (258 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

48739.m000077 conserved hypothetical protein                          135   1e-31
29854.m001117 conserved hypothetical protein                           82   2e-15

>48739.m000077 conserved hypothetical protein
          Length = 315

 Score =  135 bits (68), Expect = 1e-31
 Identities = 107/120 (89%)
 Strand = Plus / Plus

                                                                       
Query: 7   ctagaggacgggccagacgcagcagagctacaactggggagcggattccccacgggcatg 66
           ||||||||||||||||||||| |||||| |||||  ||||||||||||||||| |||| |
Sbjct: 121 ctagaggacgggccagacgcatcagagcgacaacccgggagcggattccccaccggcagg 180

                                                                       
Query: 67  gggacaggagacagctatctcggggcacatcacgacctacatgcaagacccgcaagacct 126
           |||||||||||| || |||||| |||||||||||||||||| |||| ||| || ||||||
Sbjct: 181 gggacaggagacggccatctcgaggcacatcacgacctacaggcaacaccggcgagacct 240


>29854.m001117 conserved hypothetical protein
          Length = 279

 Score = 81.8 bits (41), Expect = 2e-15
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 7   ctagaggacgggccagacgcagcagagctacaactggggagcggattccccacgggcatg 66
           ||||||||||||||| || || |||||| |||||   |||||||||||||||| || | |
Sbjct: 172 ctagaggacgggccaaacacatcagagcgacaacccaggagcggattccccaccggtagg 231

                                                    
Query: 67  gggacaggagacagctatctcggggcacatcacgacctaca 107
           |||||||||||| || || ||| ||||||||| ||||||||
Sbjct: 232 gggacaggagacggccatgtcgaggcacatcatgacctaca 272