Jatropha Genome Database
- JcCA0074091.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0074091.10 - phase: 0 /partial
(623 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29806.m000944 hypothetical protein 260 9e-69
>29806.m000944 hypothetical protein
Length = 531
Score = 260 bits (131), Expect = 9e-69
Identities = 194/215 (90%)
Strand = Plus / Plus
Query: 391 agcaacgatgtttatgatttcgatacgggagcagataagaacaagaaagaatcagttgta 450
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 7 agcaacgatgtttatgatttcgatacaggagcagataagaacaagaaagaatcagttgta 66
Query: 451 aacttggttggcagccgttcaggaaccctttttgctgcgtacttatcacttgcccttggc 510
|||||||||||||||||||||||||| | ||||||| |||||||| || | |||||||
Sbjct: 67 aacttggttggcagccgttcaggaacatctattgctgcttacttatcgctgggccttggc 126
Query: 511 ttcttggggctgacacggacatctcttggggcaggcaatgtgcaagcaatattattgctg 570
||| ||||||||||| ||||||||||||||||| ||| |||||||||||||||| |||
Sbjct: 127 ttcgtggggctgacatggacatctcttggggcaagcagcatgcaagcaatattattactg 186
Query: 571 gcttgtgcagtcatttgtggttatatatatcaggt 605
||||||||| | | |||||| |||||||| |||||
Sbjct: 187 gcttgtgcaattacttgtggctatatataccaggt 221