Jatropha Genome Database

JcCA0071331.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0071331.20 - phase: 0 /partial
         (228 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30182.m000131 Ribose-phosphate pyrophosphokinase, putative            226   4e-59

>30182.m000131 Ribose-phosphate pyrophosphokinase, putative
          Length = 981

 Score =  226 bits (114), Expect = 4e-59
 Identities = 198/226 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaagtattggcagctcatggtgccgcaaaagttagtgcatatgtcacccatggtgtgttt 60
           ||||||||||||||||||||||| || ||||| ||||||||||||||||||||||| |||
Sbjct: 751 aaagtattggcagctcatggtgctgcgaaagtgagtgcatatgtcacccatggtgtcttt 810

                                                                       
Query: 61  cctaatcgctcatgggaacgttttactcaaaaaagtgacggatcaggcagtgcatttgcc 120
           ||||| ||||| ||||| || |||||||| |||||| | || ||||  ||||| ||||||
Sbjct: 811 cctaagcgctcttgggagcgatttactcacaaaagtaatggctcagagagtgcttttgcc 870

                                                                       
Query: 121 tacttttggatcacagattcatgccctctgactgtcaaatccatcgcaaacaaacctcca 180
           || ||||||||||| |||||||||||||| ||||||||| |||| || |||||| |||||
Sbjct: 871 tatttttggatcactgattcatgccctcttactgtcaaagccatagccaacaaagctcca 930

                                                         
Query: 181 tttgaagttctgagccttgcaggatccattgcagatgcactgcaaa 226
           ||||||||| |||| ||||| || |||||||| ||||| |||||||
Sbjct: 931 tttgaagttttgagtcttgccgggtccattgctgatgctctgcaaa 976