Jatropha Genome Database

JcCA0070781.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0070781.10 - phase: 0 
         (501 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30190.m011064 Blue copper protein precursor, putative                  78   6e-14

>30190.m011064 Blue copper protein precursor, putative
          Length = 525

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                       
Query: 284 ctcctggaaagaaatggtacatttgtggtgtgcctaatcattgtgagcctggcaacatga 343
           ||||||||||||| ||||||||||||  ||||   || ||||| ||| |||| |||||||
Sbjct: 287 ctcctggaaagaagtggtacatttgtactgtgggcaagcattgcgagtctggtaacatga 346

                                                  
Query: 344 aacttactattactgtattgcctcagttgggatctccgg 382
           ||||| |||| ||||| |||||| ||||||| |||||||
Sbjct: 347 aacttgctatcactgtgttgcctgagttgggttctccgg 385



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 76  gttggtgatgagactggttggactaccaattttgattaccaagcttgggc 125
           |||||||||||||| |||||||||||||| ||| |||| ||| |||||||
Sbjct: 79  gttggtgatgagacaggttggactaccaactttaattatcaatcttgggc 128