Jatropha Genome Database

JcCA0070381.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0070381.10 - phase: 0 /pseudo/partial
         (439 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m014296 conserved hypothetical protein                           62   3e-09
30170.m014297 conserved hypothetical protein                           52   3e-06

>30170.m014296 conserved hypothetical protein
          Length = 1221

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 284 ttttttattaaatcccttaacaaaagctagaattgagcttcca 326
           |||| |||||||||| ||||| |||||||||||||||||||||
Sbjct: 315 ttttctattaaatccgttaactaaagctagaattgagcttcca 357


>30170.m014297 conserved hypothetical protein
          Length = 1221

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 13  tggtcggagcttccaccggaattgctacggaccataacccaaatacaagctaactacgtt 72
           ||||| || |||||||  ||||||||||  ||||||||||||| |||| | ||||| || 
Sbjct: 10  tggtcagaacttccacaagaattgctacaaaccataacccaaaaacaaaccaactatgtc 69

                                                             
Query: 73  gattacctctcaattagggctgtttgcaaatcatggcggtcagctatacc 122
           |||||  | || |  || |||||||||||||||||| |||| || |||||
Sbjct: 70  gattatatttccacaagagctgtttgcaaatcatggtggtctgcaatacc 119