Jatropha Genome Database

JcCA0066701.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0066701.10 - phase: 0 /partial
         (162 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29815.m000502 conserved hypothetical protein                          107   2e-23

>29815.m000502 conserved hypothetical protein
          Length = 1500

 Score =  107 bits (54), Expect = 2e-23
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggaacacaatggtttagctggtgggatattttcagggatgggatcaggagtgctagga 60
          |||| |||||| |||||| |||||||||||||||| || |||||||||||| || |||||
Sbjct: 1  atggtacacaacggtttacctggtgggatattttctggcatgggatcaggattgttagga 60

                                    
Query: 61 ctagaaatgccactacaccaagaaca 86
          ||||||||||||||||||||| ||||
Sbjct: 61 ctagaaatgccactacaccaacaaca 86