Jatropha Genome Database

JcCA0063931.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0063931.10 + phase: 1 /partial
         (281 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m013844 cytochrome P450, putative                               176   4e-44
29851.m002484 conserved hypothetical protein                           50   7e-06

>30147.m013844 cytochrome P450, putative
          Length = 303

 Score =  176 bits (89), Expect = 4e-44
 Identities = 179/209 (85%)
 Strand = Plus / Plus

                                                                       
Query: 21  atggatagcagtatagattataaggggcaggatcatgagttgttaccatttggagctggt 80
           |||| |||||||||||| | ||||||||||||   |||| |  |||| |||||||| |||
Sbjct: 1   atgggtagcagtatagactttaaggggcaggactttgagctaataccttttggagcgggt 60

                                                                       
Query: 81  agaagaatctgcccagccattgcatttggatcagcagtggttgagcttgctttagctcaa 140
           ||||||| ||||||||||||  |||||| | |||||   ||||||||||||||  |||||
Sbjct: 61  agaagaagctgcccagccatcacatttgcaacagcaaatgttgagcttgctttgactcaa 120

                                                                       
Query: 141 ctactccatagctttgattgggaacttcctgcaggagtaaaagccgctgatatagataat 200
           || ||||| ||||||||||||||||||||| |||||||||||||   |||||||||||| 
Sbjct: 121 cttctccacagctttgattgggaacttcctccaggagtaaaagctcatgatatagataac 180

                                        
Query: 201 acagaagcttttggcatatcagtgcacag 229
           ||||||||||||||||| ||| |||||||
Sbjct: 181 acagaagcttttggcatctcaatgcacag 209


>29851.m002484 conserved hypothetical protein
          Length = 705

 Score = 50.1 bits (25), Expect = 7e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 64  taccatttggagctggtagaagaatctgcccag 96
           ||||||||||| ||||||||||||| |||||||
Sbjct: 422 taccatttggatctggtagaagaatgtgcccag 454