Jatropha Genome Database

JcCA0062081.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0062081.10 + phase: 0 
         (270 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29912.m005494 conserved hypothetical protein                           52   2e-06

>29912.m005494 conserved hypothetical protein
          Length = 1041

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                      
Query: 1  atgggatcgagagacaaggaccaaatgacatcacatcaccaaccgctacttagcagactt 60
          ||||| || |||||||||||||||| |||||| ||||| || || || |||||||| || 
Sbjct: 1  atggggtcaagagacaaggaccaaacgacatcgcatcatcagccccttcttagcagcctc 60

                                                
Query: 61 gtcgttcgccctttagtcatcgatcgtggtgatggtgg 98
          ||||| || ||||  ||||  ||| | |||||||||||
Sbjct: 61 gtcgtccgtccttccgtcagtgatggcggtgatggtgg 98