Jatropha Genome Database

JcCA0059711.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0059711.10 - phase: 0 
         (201 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29801.m003204 conserved hypothetical protein                          161   2e-39
30115.m001181 conserved hypothetical protein                           60   5e-09

>29801.m003204 conserved hypothetical protein
          Length = 609

 Score =  161 bits (81), Expect = 2e-39
 Identities = 120/133 (90%)
 Strand = Plus / Plus

                                                                       
Query: 65  ctcaggcggagatcgatgagtttttcgcggaagcagagaaaaaagagcaaaaacgatttg 124
           |||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||
Sbjct: 473 ctcaggtggagatcgatgagtttttcgcggaagcagagaagaaagagcaaaaaagatttg 532

                                                                       
Query: 125 cagagaagtataactatgatgtagcgaaggatgtgccactggaaggccgttaccagtggg 184
           |||| ||||| || |||||| ||| ||||||| |||| || ||||| || ||||||||||
Sbjct: 533 cagacaagtacaattatgatatagtgaaggatttgcctcttgaaggtcgctaccagtggg 592

                        
Query: 185 ttcgtttgaagcc 197
           |||||||||||||
Sbjct: 593 ttcgtttgaagcc 605


>30115.m001181 conserved hypothetical protein
          Length = 660

 Score = 60.0 bits (30), Expect = 5e-09
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 112 caaaaacgatttgcagagaagtataactatgatgtagcgaaggatg 157
           ||||||||||||||||| ||||||||||| ||||| | ||||||||
Sbjct: 571 caaaaacgatttgcagacaagtataactacgatgtcgtgaaggatg 616