Jatropha Genome Database

JcCA0046101.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0046101.20 - phase: 0 /pseudo/partial
         (185 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27810.m000646 lysophosphatidic acid acyltransferase, putative         113   4e-25
27810.m000647 conserved hypothetical protein                           66   8e-11

>27810.m000646 lysophosphatidic acid acyltransferase, putative
          Length = 1188

 Score =  113 bits (57), Expect = 4e-25
 Identities = 141/169 (83%)
 Strand = Plus / Minus

                                                                        
Query: 7    tttgcgggggcaaccttagcaggggtcgaatgctctgactgagaaaatcgaatcaagact 66
            ||||| |||||||||| ||||||||| |||||||| || || ||||| || |||||||  
Sbjct: 1112 tttgctggggcaacctgagcaggggttgaatgctccgattgcgaaaagcgtatcaagatg 1053

                                                                        
Query: 67   tgcatgaggacagtaacaattgcaagtgcggatgccgacaatgcaatccccttccacgat 126
            ||||| ||||||||||| ||||| || || ||    ||||| ||||| |||||||| |||
Sbjct: 1052 tgcataaggacagtaacgattgccagggcagacattgacaacgcaatacccttccatgat 993

                                                             
Query: 127  gaaaaaagtgaagaccattggaggaacttccaggccccaaagataagca 175
            || |||||||| ||||| |||||||||||| | | ||||||||||||||
Sbjct: 992  gacaaaagtgatgaccactggaggaacttcaaagtcccaaagataagca 944


>27810.m000647 conserved hypothetical protein
          Length = 474

 Score = 65.9 bits (33), Expect = 8e-11
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 103 gacaatgcaatccccttccacgatgaaaaaagtgaagaccattggaggaacttccaggcc 162
           ||||||||||| |||||||| |||||  ||||||| || || |||||||||||| | | |
Sbjct: 103 gacaatgcaatacccttccatgatgacgaaagtgacgaacactggaggaacttcaaagtc 162

                        
Query: 163 ccaaagataagca 175
           |||||||||||||
Sbjct: 163 ccaaagataagca 175