Jatropha Genome Database
- JcCA0045351.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0045351.10 - phase: 0
(783 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27805.m000021 DNA binding protein, putative 200 9e-51
28118.m000034 DNA binding protein, putative 64 1e-09
29739.m003716 conserved hypothetical protein 52 5e-06
>27805.m000021 DNA binding protein, putative
Length = 573
Score = 200 bits (101), Expect = 9e-51
Identities = 364/453 (80%), Gaps = 9/453 (1%)
Strand = Plus / Plus
Query: 253 tatcgcggcatccgccaacggaaatgggggaaatgggtgtctgaaatccgggaaccaggt 312
||||| ||||| || ||||||||||||||||||||||||||||||||| | || || ||
Sbjct: 52 tatcggggcattcggcaacggaaatgggggaaatgggtgtctgaaatcagagagcccggc 111
Query: 313 aagaaaacgcgtatttggttagggagttatgaattaccggagatggcagccgcagcttat 372
|||||||| || |||||| | |||||||| || | || ||||||||||| || || |||
Sbjct: 112 aagaaaacacgcatttggctggggagttacgagtccccagagatggcagcagctgcatat 171
Query: 373 gatgtggcagcattgcatttccgaggaagtggagctcacttgaactttccggaattagtg 432
||||| || |||||||||||| |||| |||||||||||||||||| || || ||||
Sbjct: 172 gatgtagctgcattgcatttcagaggccatggagctcacttgaacttccctgagctagtt 231
Query: 433 gatagtttacctaggccagcgagctctagtgcggaggatgtgcaaatggcagcgcaagaa 492
|||||| | || | || || ||||| || || ||||| ||||||||||| || |||||
Sbjct: 232 gatagtcttccccgccctgctagctcaagcgccgaggacgtgcaaatggctgcacaagag 291
Query: 493 gcggctatgaggtttgggaataatataagggcgacaaaatgttcggaggttggtggctgc 552
|| ||| |||||||| | |||| ||| ||||||||| ||||| || | ||
Sbjct: 292 gctgctgtgaggtttag---------aaggccgataaaatgttcagaggtgggcagtggc 342
Query: 553 ggcggctctggtggaggtagtggtggcgttggcgatggtttaggtcctgtaaggattggg 612
|| ||| |||| | ||| | || ||| ||||| ||||| | |||||| ||||||||
Sbjct: 343 ggtggcggtggttgcggtggcggcggctctggcggcggtttggttcctgttaggattgga 402
Query: 613 ctttcgcctagtcaaattcaagctattaatgagacgccattggattcaccaaagatgtgg 672
|| |||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 403 ctctcgcctagccaaattcaagctataaatgagacaccattggattcaccaaagatgtgg 462
Query: 673 atggagttggctggggctctattattagcagag 705
|||||| ||||||||||||| || ||||||||
Sbjct: 463 atggagctggctggggctctcttgctagcagag 495
>28118.m000034 DNA binding protein, putative
Length = 648
Score = 63.9 bits (32), Expect = 1e-09
Identities = 86/104 (82%)
Strand = Plus / Plus
Query: 274 aaatgggggaaatgggtgtctgaaatccgggaaccaggtaagaaaacgcgtatttggtta 333
||||||||||| ||||||||||| || || ||||| || |||||||| | |||||||||
Sbjct: 148 aaatgggggaagtgggtgtctgagatacgcgaacccgggaagaaaactaggatttggtta 207
Query: 334 gggagttatgaattaccggagatggcagccgcagcttatgatgt 377
|| |||| ||| ||| || ||||||||| | |||||||||||
Sbjct: 208 ggtagttttgagacacctgaaatggcagccactgcttatgatgt 251
Score = 56.0 bits (28), Expect = 3e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 628 attcaagctattaatgagacgccattggattcaccaaagatgtggatg 675
||||||||||| |||||| | |||||||| ||||| ||||||||||||
Sbjct: 502 attcaagctatcaatgagtcaccattggactcacccaagatgtggatg 549
>29739.m003716 conserved hypothetical protein
Length = 477
Score = 52.0 bits (26), Expect = 5e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 274 aaatgggggaaatgggtgtctgaaat 299
||||||||||||||||||||||||||
Sbjct: 76 aaatgggggaaatgggtgtctgaaat 101