Jatropha Genome Database
- JcCA0045271.30
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0045271.30 - phase: 0 /partial
(366 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29929.m004545 ATP binding protein, putative 98 4e-20
>29929.m004545 ATP binding protein, putative
Length = 4167
Score = 97.6 bits (49), Expect = 4e-20
Identities = 106/125 (84%)
Strand = Plus / Plus
Query: 1 gtacttggagatgtaatagagtctctagctggggctatttatgttgattcaggatacaac 60
|||||||| ||||| ||||| || || ||||||||||| | ||||||||| || ||||||
Sbjct: 3817 gtacttggggatgtgatagaatcactggctggggctatatttgttgattctgggtacaac 3876
Query: 61 aaagaagcagtctttcggagcataaggccacttttggagcctttgattactccagagaca 120
||||| | || ||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 3877 aaagaggttgtatttaacagcataaggccacttttggagccactgattactccagagacc 3936
Query: 121 attag 125
|||||
Sbjct: 3937 attag 3941