Jatropha Genome Database
- JcCA0040481.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0040481.10 + phase: 0
(294 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29838.m001690 mads box protein, putative 224 2e-58
30099.m001672 mads box protein, putative 60 8e-09
>29838.m001690 mads box protein, putative
Length = 186
Score = 224 bits (113), Expect = 2e-58
Identities = 158/173 (91%)
Strand = Plus / Plus
Query: 1 atgacaaggcagaaaatccagataaaaaagattgacaacaatacagcaagacaagtgact 60
||||||||||| ||||||||||| || |||||||| |||| ||||||||||||||||||
Sbjct: 1 atgacaaggcaaaaaatccagatcaagaagattgataacataacagcaagacaagtgact 60
Query: 61 ttttctaagagaagaagagggcttttcaagaaagcatatgagctctccactctttgtgat 120
||||| ||||||||||||||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 61 ttttcaaagagaagaagagggcttttcaagaaagcttatgaactatcaactctttgtgat 120
Query: 121 gctgagattgctcttatagtcttttctggaactggaaagctttttgagtatgc 173
|||||||| |||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 121 gctgagatagctcttttagtcttttctgctactggaaagctttttgagtatgc 173
>30099.m001672 mads box protein, putative
Length = 654
Score = 60.0 bits (30), Expect = 8e-09
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 79 gggcttttcaagaaagcatatgagctctccactctttgtgatgctgagattgct 132
|||||||||||||| || |||||| ||||||||||||| |||||||||||||
Sbjct: 94 gggcttttcaagaaggctagtgagctttccactctttgtggtgctgagattgct 147