Jatropha Genome Database

JcCA0029841.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0029841.20 + phase: 0 
         (786 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29727.m000494 conserved hypothetical protein                           96   4e-19

>29727.m000494 conserved hypothetical protein
          Length = 810

 Score = 95.6 bits (48), Expect = 4e-19
 Identities = 99/116 (85%)
 Strand = Plus / Plus

                                                                       
Query: 379 gcacaaatgactatattttacggcggtcgggtgatggtatttgatgattttccggctgat 438
           |||||||||||||||||||||||||| |  || |||||||||||||||||||||||||| 
Sbjct: 376 gcacaaatgactatattttacggcggacaagttatggtatttgatgattttccggctgag 435

                                                                   
Query: 439 aaggcgaaggaaatatttgctttagctgcaaaaggaagctctaatactacaaatgg 494
           ||||| || || ||  | |||||||||   |||||||  ||||| |||||||||||
Sbjct: 436 aaggccaaagagatcatagctttagctagcaaaggaacatctaacactacaaatgg 491



 Score = 83.8 bits (42), Expect = 1e-15
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 610 gatttaccaattgctagaagagcatcgcttcatcggttcttagaaaagaggaaagaaagg 669
           ||||| || ||||||||||||||||| || ||||||||||| || ||||||||||| |||
Sbjct: 598 gatttgcctattgctagaagagcatcactgcatcggttctttgagaagaggaaagacagg 657

                                     
Query: 670 gcttcatcaaaagcaccatatcaaat 695
           ||  || |||| ||||||||||||||
Sbjct: 658 gcggcagcaaaggcaccatatcaaat 683