Jatropha Genome Database

JcCA0028741.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0028741.30 + phase: 0 
         (1074 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29669.m000837 conserved hypothetical protein                           84   2e-15
29226.m000080 conserved hypothetical protein                           54   2e-06
29908.m006116 conserved hypothetical protein                           52   7e-06

>29669.m000837 conserved hypothetical protein
          Length = 1131

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 94/110 (85%), Gaps = 1/110 (0%)
 Strand = Plus / Plus

                                                                        
Query: 457  tttataggagccaaggactggctgagattgcctagtgaagaacttgccactgcttttgat 516
            ||||||||||| || |||||||| | ||||||   ||| || ||||||||||| ||| | 
Sbjct: 916  tttataggagctaaagactggctaaaattgccgtctgaggagcttgccactgcctttcac 975

                                                              
Query: 517  agccctctaattataaggca-ccctcaaggacatactgtcccaagacttg 565
            |||||||||||||||||||| ||| ||||| |||||| ||||||||||||
Sbjct: 976  agccctctaattataaggcaccccccaagggcatactatcccaagacttg 1025


>29226.m000080 conserved hypothetical protein
          Length = 864

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 259 ggtccttttgatggtttgctcggcttctctcaggg 293
           |||||||||||||||||||| || |||||||||||
Sbjct: 478 ggtccttttgatggtttgcttggtttctctcaggg 512


>29908.m006116 conserved hypothetical protein
          Length = 675

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 172 gagtggttccagtacaaccaggattttacagagtatacaaac 213
           ||||||||||||| ||||  ||| ||||||||||||||||||
Sbjct: 202 gagtggttccagttcaacgcggaatttacagagtatacaaac 243