Jatropha Genome Database

JcCA0025111.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0025111.20 + phase: 0 
         (186 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014133 mads box protein, putative                               78   2e-14
30190.m011099 conserved hypothetical protein                           68   2e-11
30174.m008934 mads box protein, putative                               56   7e-08

>30147.m014133 mads box protein, putative
          Length = 642

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtgagaggaaagactcaaatgaggcgcatagagaacgccacaagcaggcaagttact 60
           |||||||||||||||| |||||||||| | || || || ||||||||||||||||| || 
Sbjct: 1   atggtgagaggaaagattcaaatgaggaggattgaaaatgccacaagcaggcaagtgacc 60

                                                                       
Query: 61  ttctccaaacgccgtaatgggctgctaaagaaggcatttgagctctcagttctttgtgat 120
           ||||| || ||  | ||||||||  | ||||| || | |||||| |||||||| ||||||
Sbjct: 61  ttctcaaagcgaagaaatgggcttttgaagaaagcttatgagctatcagttctatgtgat 120

                      
Query: 121 gctgaggttgc 131
           || || |||||
Sbjct: 121 gcagaagttgc 131


>30190.m011099 conserved hypothetical protein
          Length = 345

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 1   atggtgagaggaaagactcaaatgaggcgcatagagaacgccacaagcaggcaa 54
           |||||||||||||||||||| |||| | | ||||||||||| ||||||||||||
Sbjct: 266 atggtgagaggaaagactcagatgaagagaatagagaacgcaacaagcaggcaa 319


>30174.m008934 mads box protein, putative
          Length = 735

 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 99  tgagctctcagttctttgtgatgctgaggttgcccttattgtcttctc 146
           |||||| || || |||||||||||||||||||| |||||| |||||||
Sbjct: 99  tgagctgtctgtgctttgtgatgctgaggttgctcttattatcttctc 146