Jatropha Genome Database

JcCA0022141.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0022141.10 + phase: 0 
         (327 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29596.m000699 mads box protein, putative                               82   2e-15
29804.m001536 mads box protein, putative                               78   4e-14

>29596.m000699 mads box protein, putative
          Length = 789

 Score = 81.8 bits (41), Expect = 2e-15
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagagggaagattgtgattcgaagaattgataattctacaagcagacaagttacc 60
           ||||| ||||||||||| |||||  ||||||| || ||||| |||||||| ||||| || 
Sbjct: 1   atggggagagggaagatagtgataagaagaatagacaattccacaagcaggcaagtgacg 60

                                                                       
Query: 61  ttttcgaaacgacgaaagggtttgattaagaaagcaaaagagttggcaattctttgtgat 120
           ||||| ||| || | || || ||  | ||||| ||||| ||| | || ||||||||||| 
Sbjct: 61  ttttcaaaaagaaggaatggattattgaagaaggcaaaggagctcgcgattctttgtgac 120

                                                    
Query: 121 gcagaagttggacttgttatcttttctagctccggcaagct 161
           || ||||||||| |||| || ||||||||| ||||||||||
Sbjct: 121 gctgaagttggagttgtgatattttctagcaccggcaagct 161


>29804.m001536 mads box protein, putative
          Length = 801

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagagggaagattgtgattcgaagaattgataattctacaagcagacaagttacc 60
           |||||||||||||| |||||||| || || ||||||||||| || || || ||||| || 
Sbjct: 82  atgggaagagggaaaattgtgatccgtaggattgataattcaacgagtaggcaagtgact 141

                                                                       
Query: 61  ttttcgaaacgacgaaagggtttgattaagaaagcaaaagagttggcaattctttgtgat 120
           || || ||  || |||| || ||| | |||||||| | ||||||| |||||||||| |||
Sbjct: 142 ttctcaaagagaagaaatgggttgctaaagaaagctagagagttgtcaattctttgcgat 201

                      
Query: 121 gcagaagttgg 131
           |||||||||||
Sbjct: 202 gcagaagttgg 212