Jatropha Genome Database

JcCA0020761.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0020761.20 - phase: 0 
         (753 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30128.m008873 hypothetical protein                                    111   6e-24

>30128.m008873 hypothetical protein
          Length = 825

 Score =  111 bits (56), Expect = 6e-24
 Identities = 98/112 (87%)
 Strand = Plus / Plus

                                                                       
Query: 642 ggagctttgcaagaagaggatcctaatgggggagaagtgcaggccactgagttattctgg 701
           |||||| ||||||||||||||| ||||||| | ||||||||||||||| | | |||||||
Sbjct: 714 ggagctgtgcaagaagaggatcttaatgggagggaagtgcaggccactcaataattctgg 773

                                                               
Query: 702 cacccttcaatatgataaagatgggactttgttaccagatgccattccatga 753
            || ||||| |||||||||||||||  |||||||||||||  ||||||||||
Sbjct: 774 tactcttcagtatgataaagatggggttttgttaccagatatcattccatga 825