Jatropha Genome Database

JcCA0012011.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0012011.10 - phase: 0 
         (561 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28118.m000034 DNA binding protein, putative                            94   1e-18
27805.m000021 DNA binding protein, putative                            60   1e-08

>28118.m000034 DNA binding protein, putative
          Length = 648

 Score = 93.7 bits (47), Expect = 1e-18
 Identities = 133/164 (81%)
 Strand = Plus / Plus

                                                                       
Query: 46  agaggggtacgtaagcgaaaatgggggaaatgggtatcggagatccgtgagccagggnnn 105
           ||||| ||||||||| ||||||||||||| ||||| || ||||| || || || |||   
Sbjct: 130 agaggtgtacgtaagagaaaatgggggaagtgggtgtctgagatacgcgaacccgggaag 189

                                                                       
Query: 106 nnnnccagaatatggttagggagtttcgaaacgccagaaatggcagcagcagcttatgat 165
               | || || |||||||| ||||| || || || |||||||||||  | |||||||||
Sbjct: 190 aaaactaggatttggttaggtagttttgagacacctgaaatggcagccactgcttatgat 249

                                                       
Query: 166 gtagcggctttgcatttcagaggacgtgaagctaagcttaattt 209
           || || |||||  |||||||||||||||||||||||||||||||
Sbjct: 250 gttgctgctttatatttcagaggacgtgaagctaagcttaattt 293



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 418 attcaggctattaacgagtctcctttggattcaccgaagatgtggatgcaaatggcaa 475
           ||||| ||||| || ||||| || ||||| ||||| ||||||||||||||||||||||
Sbjct: 502 attcaagctatcaatgagtcaccattggactcacccaagatgtggatgcaaatggcaa 559


>27805.m000021 DNA binding protein, putative
          Length = 573

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 139 ccagaaatggcagcagcagcttatgatgtagcggctttgcatttcagagg 188
           ||||| ||||||||||| || ||||||||||| || ||||||||||||||
Sbjct: 148 ccagagatggcagcagctgcatatgatgtagctgcattgcatttcagagg 197