Jatropha Genome Database

JcCA0011081.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0011081.10 - phase: 0 
         (645 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30068.m002642 Plastid lipid-associated protein 3, chloroplast pr...    92   5e-18

>30068.m002642 Plastid lipid-associated protein 3, chloroplast
           precursor, putative
          Length = 1104

 Score = 91.7 bits (46), Expect = 5e-18
 Identities = 100/118 (84%)
 Strand = Plus / Plus

                                                                       
Query: 475 ttaaagaggattttggtagatacagtttatgggactaattttgggtttcaggctagcccg 534
           |||||||||  |||||| ||||| |||||||| ||||| || ||||||||||| ||||| 
Sbjct: 433 ttaaagaggtgtttggtggatacggtttatggaactaaattcgggtttcaggccagcccc 492

                                                                     
Query: 535 gagatcagagctgaggttttggagttggttaatcagttagaggccatgaacccaactc 592
           || || || |  |||||||||||||| ||||||||||| |||||  ||||||||||||
Sbjct: 493 gaaattaggggagaggttttggagttagttaatcagttggaggctctgaacccaactc 550