Jatropha Genome Database

JcCA0006671.80
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0006671.80 + phase: 0 
         (405 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30146.m003601 Peroxidase 57 precursor, putative                        68   4e-11

>30146.m003601 Peroxidase 57 precursor, putative
          Length = 1314

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 314 ctccggctctcttgaggcttgctttccatgattgtttcattg 355
           |||| |||||||||||||||| ||||||||||||||||||||
Sbjct: 320 ctcctgctctcttgaggcttgttttccatgattgtttcattg 361