Jatropha Genome Database

JcCA0003732.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0003732.30 - phase: 0 /pseudo/partial
         (440 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29976.m000496 conserved hypothetical protein                           88   5e-17

>29976.m000496 conserved hypothetical protein
          Length = 375

 Score = 87.7 bits (44), Expect = 5e-17
 Identities = 157/196 (80%), Gaps = 9/196 (4%)
 Strand = Plus / Plus

                                                                       
Query: 90  tgtggaagggtgtattgcaggaactgcgtgagcataggaatgggagagatgacagaagga 149
           |||||||| || ||||||||||| |||||| |||||||||||||||| ||| | ||||||
Sbjct: 10  tgtggaagagtatattgcaggaattgcgtgggcataggaatgggagaaatgtcggaagga 69

                                                                       
Query: 150 agaaaatgcattcaatgtttgggaagaagatt---------gtatataaaaagggcagga 200
           |||||||| || || ||||| || ||| | ||         ||| ||| |||||||||| 
Sbjct: 70  agaaaatgtatccagtgtttagggagacggttcagccaaaggtacatacaaagggcaggg 129

                                                                       
Query: 201 aacgtagggtgttgttcaacttatccaagcagtgtaaggcaggcagagcttagatgggca 260
           |  || |||||||||||||  |||||||||| ||||| |||||||||||| |  ||||| 
Sbjct: 130 atggtggggtgttgttcaaggtatccaagcactgtaaagcaggcagagctcaagtgggcg 189

                           
Query: 261 gaaaaaggacctagaa 276
           || |||||||| ||||
Sbjct: 190 gagaaaggaccgagaa 205