Jatropha Genome Database
- JcCA0000051.30
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0000051.30 + phase: 2 /pseudo/partial
(1087 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
27985.m000842 kinase, putative 74 2e-12
>27985.m000842 kinase, putative
Length = 2091
Score = 73.8 bits (37), Expect = 2e-12
Identities = 85/101 (84%)
Strand = Plus / Plus
Query: 528 gttgcttctgctcttacgtatcgtcacgaagaatgcaagagacaaatcattcacagagat 587
||||||||||||||| |||||| ||||| ||| | | || || || ||||| ||||||
Sbjct: 1450 gttgcttctgctctttcgtatctacacgaggaaagtgaaaggcagataattcatagagat 1509
Query: 588 gtgaagccctgcaatataatgcttgatgcagatttcaatgc 628
|| ||| ||||||||||||||||||||| ||| ||||||||
Sbjct: 1510 gtcaagacctgcaatataatgcttgatgaagaattcaatgc 1550
Score = 71.9 bits (36), Expect = 8e-12
Identities = 63/72 (87%)
Strand = Plus / Plus
Query: 313 cgcaatcctttcaccactgagtttgcaacaatggtgggttgcttaaggcacaagaacttg 372
|||||||| |||| ||||||||||||||||| ||||||||||||| || || ||||||
Sbjct: 1240 cgcaatccattcataactgagtttgcaacaattgtgggttgcttaaaacataataacttg 1299
Query: 373 gttcagcttcaa 384
||||| ||||||
Sbjct: 1300 gttcaacttcaa 1311