Jatropha Genome Database
- JcCB0537261.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0537261.10 - phase: 0 /partial
(938 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c04568 56 2e-07
>KJC_c04568
Length = 884
Score = 56.0 bits (28), Expect = 2e-07
Identities = 73/88 (82%)
Strand = Plus / Minus
Query: 587 aagaacaagaagcatttataccacttgttgaggaaattatagaggttggaggtggtttta 646
|||| ||||| | |||||||||| ||||||||||||||| ||| || | ||| || ||||
Sbjct: 438 aagatcaagaggaatttataccaattgttgaggaaattacagaagtagcaggaggattta 379
Query: 647 gtatagctgatttgttcccttctattaa 674
|| | || |||||||| |||||| ||||
Sbjct: 378 gtcttgcagatttgtttccttctgttaa 351
Score = 52.0 bits (26), Expect = 2e-06
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 212 ttatgcatcttcagcttggtgaagtt 237
||||||||||||||||||||||||||
Sbjct: 813 ttatgcatcttcagcttggtgaagtt 788