Jatropha Genome Database

JcCB0482031.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0482031.10 - phase: 2 /partial
         (397 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c00736                                                             68   2e-11
KJC_c01000                                                             62   1e-09

>KJC_c00736 
          Length = 1204

 Score = 67.9 bits (34), Expect = 2e-11
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 11  caagttttgattcttgatcacgaagcagttggtgggattgtaactcattgtggatggaat 70
           ||||| ||||||||||| || ||||||||||| ||  |||| ||||||||||||||||||
Sbjct: 423 caagtgttgattcttgaacatgaagcagttggaggatttgtgactcattgtggatggaat 364

             
Query: 71  tc 72
           ||
Sbjct: 363 tc 362



 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 aagcagaggaaattagaaacagagcaaaaaagattggagaaatggcaagaaaagctgttg 332
           ||||||||||||| |||| ||||||||  | | ||||||| ||||| ||| ||| |||||
Sbjct: 160 aagcagaggaaatgagaagcagagcaaggaggcttggagagatggcgagacaagttgttg 101

                               
Query: 333 aagatgggggctcttcttac 352
           |||| || || |||||||||
Sbjct: 100 aagaaggtggatcttcttac 81


>KJC_c01000 
          Length = 1154

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 53  actcattgtggatggaattctgctttagaaggtattagtgctgggctgccaatggtaac 111
           |||||||||||||||||||| | ||| |||||| | ||||||||  |||||||||||||
Sbjct: 299 actcattgtggatggaattcagttttggaaggtgtgagtgctggagtgccaatggtaac 241