Jatropha Genome Database
- JcCB0354791.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0354791.10 - phase: 1 /partial
(308 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c00063 157 2e-38
>KJC_c00063
Length = 1602
Score = 157 bits (79), Expect = 2e-38
Identities = 199/239 (83%)
Strand = Plus / Plus
Query: 7 agacattcagtgaagctttggaaaccaccaagaccgtcatctggaatggaccaatgggag 66
|||||||| |||||||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 1016 agacattctgtgaagctttagatactaccaaaacggttatttggaatggaccaatgggtg 1075
Query: 67 tgtttgaatttgacaagtttgcagttgggacagaggctattgcaaagaagctagcagagc 126
| ||||| || || ||||||||||| || || ||||| ||||| |||||||| |||||||
Sbjct: 1076 tatttgagttcgaaaagtttgcagtgggaactgaggcaattgccaagaagcttgcagagc 1135
Query: 127 tcagtggcaagggagtgacaacaattattggaggtggagattctgttgcagctgtagaaa 186
||||||||||||| |||||||| || ||||||||||| || || ||||| ||||| || |
Sbjct: 1136 tcagtggcaagggcgtgacaactatcattggaggtggtgactcagttgctgctgtggaga 1195
Query: 187 aagtaggagttgctgatgttatgagccacatatcaactggtggtggtgccagtttggag 245
| || || ||||||| ||||||||||| || ||||| ||||||||||| ||||||
Sbjct: 1196 aggttgggcttgctgacaagatgagccacatctcgactggaggtggtgccagcttggag 1254