Jatropha Genome Database

JcCB0259591.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0259591.20 - phase: 0 
         (1338 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c00739                                                             90   2e-17
KJC_c12532                                                             52   4e-06

>KJC_c00739 
          Length = 1238

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 66/73 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1156 agagaagcattggttgagctttgtggagatgagtatgtgcagagaatgacatttgatagc 1215
            ||||||||||| || ||| | |||| |||||||||||||||||  |||||||||||||||
Sbjct: 269  agagaagcatttgtggagatgtgtgcagatgagtatgtgcagaagatgacatttgatagc 210

                         
Query: 1216 tatttgtataaga 1228
            |||||||||||||
Sbjct: 209  tatttgtataaga 197



 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 123/155 (79%)
 Strand = Plus / Minus

                                                                       
Query: 619 gccattgcatttcaagagagaatcagactccccgacgagaaaatggagtactatcaaaat 678
           |||||||| ||||| |||||||||||| |||| || || ||||||| ||||||| | || 
Sbjct: 803 gccattgcttttcaggagagaatcagaatcccagatgaaaaaatggtgtactatgagaac 744

                                                                       
Query: 679 ctcgcggagatgtacgtcggcgatgacgtgtcacccgatttttacgcgtgggtatttcct 738
           || || || ||||| || || ||||| || ||||| || || || |  ||||| || || 
Sbjct: 743 ctagcagaaatgtatgttggtgatgatgtttcaccagacttctatggatgggttttcccc 684

                                              
Query: 739 aaatgcgaccacgtggcagtaggaactggtacagt 773
           ||||| |||||||| || || |||||||| |||||
Sbjct: 683 aaatgtgaccacgtagctgttggaactggcacagt 649



 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 222  caagccatgcggcggcgccattcctctttgcatg 255
            ||||||||||||||| || |||||||||||||||
Sbjct: 1227 caagccatgcggcggagctattcctctttgcatg 1194


>KJC_c12532 
          Length = 891

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 619 gccattgcatttcaagagagaatcagactccccgacgagaaaatggagtactat 672
           |||||||| ||||| |||||||||||| |||| || || ||||||| |||||||
Sbjct: 543 gccattgcttttcaggagagaatcagaatcccagatgaaaaaatggtgtactat 596