Jatropha Genome Database
- JcCB0234291.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0234291.10 - phase: 1 /partial
(1310 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c06276 68 6e-11
KJC_c09355 56 2e-07
>KJC_c06276
Length = 537
Score = 67.9 bits (34), Expect = 6e-11
Identities = 73/86 (84%)
Strand = Plus / Plus
Query: 996 agtgctgccatgggatacctggctcctgagtacacaactactggccgtttcactgaaaag 1055
||||||||||||||||| || ||||| ||||||| |||||| || | ||| |||||||||
Sbjct: 126 agtgctgccatgggatatctagctccagagtacataactaccggacattttactgaaaag 185
Query: 1056 agtgatgtttatgcatttggtgtgat 1081
| || || ||||||||||| |||||
Sbjct: 186 ggcgacgtctatgcatttggagtgat 211
>KJC_c09355
Length = 388
Score = 56.0 bits (28), Expect = 2e-07
Identities = 31/32 (96%)
Strand = Plus / Plus
Query: 483 actcagtgcttctctgaggtgaatttgttggg 514
||||| ||||||||||||||||||||||||||
Sbjct: 78 actcaatgcttctctgaggtgaatttgttggg 109