Jatropha Genome Database

JcCB0211071.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0211071.10 + phase: 0 /pseudo/partial
         (699 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c05276                                                             78   3e-14

>KJC_c05276 
          Length = 604

 Score = 77.8 bits (39), Expect = 3e-14
 Identities = 97/115 (84%), Gaps = 1/115 (0%)
 Strand = Plus / Plus

                                                                       
Query: 399 taacagaggaggatgaattt-tgatcattgggtgtgatggcatatgggatgtcatttcaa 457
           |||||||||| ||||||||| | || ||||| |||||||| || |||||||| || ||||
Sbjct: 89  taacagaggatgatgaatttcttataattggttgtgatgggatttgggatgttatgtcaa 148

                                                                  
Query: 458 gccaggaagctgtcagctttgtccgtcgtggtctcaggcggcacgatgacccaga 512
           | ||| | ||||||||| ||||||||||||| ||  | ||||| |||||||||||
Sbjct: 149 gtcagcatgctgtcagccttgtccgtcgtgggctgcgtcggcatgatgacccaga 203