Jatropha Genome Database
- JcCB0207431.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0207431.10 + phase: 2 /partial
(406 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c03276 92 1e-18
>KJC_c03276
Length = 947
Score = 91.7 bits (46), Expect = 1e-18
Identities = 124/150 (82%)
Strand = Plus / Plus
Query: 13 taaatggggctatgagaaaattcaccatgtccaccatcaatacactgctcctataggatt 72
|||||||||||||||||||||||| | |||||| || |||| ||||||| || || ||
Sbjct: 248 taaatggggctatgagaaaattcatcgtgtccatcacgaatatgctgctccaattggttt 307
Query: 73 ggcagcaccatatgcacactgggctgagattttgattcttggatttcctgcatttcttgg 132
|| ||||||||||||||||||||||| || ||||| || ||| |||| | ||||||||
Sbjct: 308 tgctgcaccatatgcacactgggctgaaatattgatcctgggaattccgtcttttcttgg 367
Query: 133 tcctgcattagttcctggccacataatcac 162
|| ||| | |||||||| ||||| |||||
Sbjct: 368 gccagcaatggttcctgggcacatgatcac 397
Score = 77.8 bits (39), Expect = 2e-14
Identities = 100/119 (84%), Gaps = 1/119 (0%)
Strand = Plus / Plus
Query: 242 aaatatattccattctatggaggtgcagagtaccatgactaccatcactgtgtgggtgcc 301
|||||||||||||| ||||| |||||||| |||||||| |||||||| | ||| || |
Sbjct: 477 aaatatattccattttatggtggtgcagattaccatgattaccatcattatgttggaggg 536
Query: 302 caaagccaaagcaactttgcgtcaattttcacttattgtgattatatttatggaactga 360
|| ||||| ||||||||||| ||| | ||||| || ||||| | |||||||||||||||
Sbjct: 537 cagagccagagcaactttgcttcagtgttcacctactgtgact-tatttatggaactga 594