Jatropha Genome Database
- JcCB0198581.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0198581.20 - phase: 0 /pseudo/partial
(1365 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c11756 54 9e-07
>KJC_c11756
Length = 579
Score = 54.0 bits (27), Expect = 9e-07
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 820 gagatgaacccaaaaatttcagattttggcatggc 854
||||||||||| |||||| ||||||||||||||||
Sbjct: 374 gagatgaacccgaaaattgcagattttggcatggc 340