Jatropha Genome Database

JcCB0193021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0193021.10 + phase: 0 /partial
         (1209 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c09716                                                             68   5e-11

>KJC_c09716 
          Length = 530

 Score = 67.9 bits (34), Expect = 5e-11
 Identities = 127/158 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1027 attgatgaacgaagcctctgttgtggaactcctcctgactgtgagtggaaggctcaagca 1086
            |||||||| || || ||||| ||||| || || ||||| || ||||||||||| || |||
Sbjct: 239  attgatgaccggagactctgctgtggtacaccgcctgattgcgagtggaaggcccaggca 180

                                                                        
Query: 1087 gggaatccttgcgctgcatcatttgattggacctgcagcggcatttgcaagtcagtggag 1146
            || ||    |||| ||| ||||||||||||| |||||| || ||||||||||| || || 
Sbjct: 179  ggcaacatctgcgttgcttcatttgattggagctgcagtgggatttgcaagtccgttgat 120

                                                  
Query: 1147 agaatggtggaggtacatcagcgctgtggggaaggtga 1184
            |||||   |||||| || | ||| ||||||||||||||
Sbjct: 119  agaatcaaggaggttcaccggcgttgtggggaaggtga 82



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 832 gtgaagtaccatgagccagaatactggaaatttggcgaggagggaaataagtattttaga 891
           ||||| |||||||| || || || ||||||||||| || || ||||| ||||||||  | 
Sbjct: 434 gtgaaataccatgaacctgagtattggaaatttggggaagaaggaaacaagtatttccgt 375

                                                       
Query: 892 catgcaacagggcaaatatatgcaatttctaaagatttggccac 935
           || || ||||||||  ||||||| ||||| || |||||||||||
Sbjct: 374 cacgctacagggcagctatatgctatttcaaatgatttggccac 331