Jatropha Genome Database

JcCB0187031.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0187031.10 + phase: 0 
         (1377 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c06964                                                             82   4e-15
KJC_c00187                                                             78   6e-14

>KJC_c06964 
          Length = 561

 Score = 81.8 bits (41), Expect = 4e-15
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 793 ggagaagaaattgcccatacatataaccatatttacggtctttcacttaccggtttacgc 852
           ||||| |||||||| ||||| ||||| |||||||| ||||||||| |||| || ||| | 
Sbjct: 355 ggagaggaaattgctcatacttataatcatatttatggtctttcaattactgggttaagg 414

                                                                
Query: 853 ttttttactgtctacggtccttggggtagaccggacatggcgtatttcttttt 905
           || |||||||| || ||||| ||||| ||||| || ||||| |||||||||||
Sbjct: 415 ttctttactgtttatggtccatggggcagacctgatatggcttatttcttttt 467


>KJC_c00187 
          Length = 1301

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 799 gaaattgcccatacatataaccatatttacggtctttcacttaccggtttacgctttttt 858
           |||||| |||| || |||||||| ||||||||||||||| |||| || ||  | ||||||
Sbjct: 536 gaaattacccacacttataaccacatttacggtctttcaattactgggttgagatttttt 477

                                                      
Query: 859 actgtctacggtccttggggtagaccggacatggcgtatttct 901
           || || |||||||| ||||| ||||| || |||||||||||||
Sbjct: 476 accgtgtacggtccatggggaagacccgatatggcgtatttct 434