Jatropha Genome Database

JcCB0186071.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0186071.10 - phase: 0 
         (204 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c08529                                                            143   2e-34
KJC_c11056                                                             92   6e-19

>KJC_c08529 
          Length = 473

 Score =  143 bits (72), Expect = 2e-34
 Identities = 126/136 (92%), Gaps = 6/136 (4%)
 Strand = Plus / Minus

                                                                       
Query: 47  caaggcaagtgaccttttcgaagagaagacgagggcttttcaagaaagctgaggagcttt 106
           |||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||
Sbjct: 473 caaggcaagtgaccttttcgaa-agaagacgagg-cttttcaa-aaagctgaggagcttt 417

                                                                       
Query: 107 ctgttctttgcgatgctgaggttgctcttatcgttttttctgctactgggaagctatttg 166
           |||| ||||||||||||||| |||||||||||  |||| |||||||||||||||||||||
Sbjct: 416 ctgt-ctttgcgatgctgag-ttgctcttatcagtttt-ctgctactgggaagctatttg 360

                           
Query: 167 agtattctagctccag 182
           ||||| ||||| ||||
Sbjct: 359 agtatgctagcaccag 344


>KJC_c11056 
          Length = 774

 Score = 91.7 bits (46), Expect = 6e-19
 Identities = 91/106 (85%)
 Strand = Plus / Plus

                                                                       
Query: 77  gagggcttttcaagaaagctgaggagctttctgttctttgcgatgctgaggttgctctta 136
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||||||||
Sbjct: 129 gaggcctttttaagaaagctgaagagctttctgttctttgcgacgctgatgttgctctta 188

                                                         
Query: 137 tcgttttttctgctactgggaagctatttgagtattctagctccag 182
           |  | ||||| |||||||| ||| | ||||| ||||  ||||||||
Sbjct: 189 ttatcttttccgctactggcaagatgtttgattattgcagctccag 234