Jatropha Genome Database

JcCB0177351.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0177351.10 + phase: 0 
         (1200 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c12439                                                             56   2e-07

>KJC_c12439 
          Length = 729

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 535 tttgatggaatcgagatccatggggctcatggttacctcattga 578
           ||||||||| | ||||||||||||||||||||||| || |||||
Sbjct: 619 tttgatggagttgagatccatggggctcatggttatcttattga 662