Jatropha Genome Database

JcCB0164341.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0164341.10 + phase: 0 /pseudo/partial
         (864 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c06961                                                             54   6e-07

>KJC_c06961 
          Length = 480

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 156 aagcctccaaaattttacggagagccattaaattgcctgaagttatggagagctgttat 214
           |||||||| || || || ||||||  |||||||||||||||||| ||| ||||||||||
Sbjct: 104 aagcctcctaagttctatggagagggattaaattgcctgaagttgtggcgagctgttat 46