Jatropha Genome Database

JcCB0143831.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0143831.10 + phase: 0 /pseudo/partial
         (2271 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c04668                                                             74   2e-12
KJC_c01449                                                             68   1e-10

>KJC_c04668 
          Length = 577

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1894 gcaatggtgggagatggaataaacgactccccagccttagttgcagctgatgttggcatg 1953
            ||||||||||| ||||| || |||||||| || || |||| ||| ||||||||||| |||
Sbjct: 105  gcaatggtgggtgatggtatcaacgactctcccgctttagctgctgctgatgttggtatg 164

                                                     
Query: 1954 gcaattggtgctggcactgatgtagccatagaagcagctga 1994
            |||||||| ||||| || ||  | ||||||||||| |||||
Sbjct: 165  gcaattggggctgggacagacattgccatagaagctgctga 205


>KJC_c01449 
          Length = 1132

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1894 gcaatggtgggagatggaataaacgactccccagccttagttgcagctgatgttggcatg 1953
            ||||||||||| ||||| || |||||||| || || |||| ||| ||||||||||| |||
Sbjct: 945  gcaatggtgggtgatggtatcaacgactctcccgctttagctgctgctgatgttggtatg 1004

                          
Query: 1954 gcaattggtgctgg 1967
            |||||||| |||||
Sbjct: 1005 gcaattggggctgg 1018