Jatropha Genome Database
- JcCB0121711.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0121711.10 + phase: 0 /partial
(459 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c02531 52 1e-06
>KJC_c02531
Length = 1010
Score = 52.0 bits (26), Expect = 1e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 153 tgcaaaaggggatgtttacagctttggagttgttctgctagagcttttgactgg 206
||||||| | ||||| ||||||||||| |||||| |||| |||||| |||||||
Sbjct: 541 tgcaaaaagtgatgtgtacagctttggtgttgttttgctcgagcttctgactgg 594