Jatropha Genome Database
- JcCB0111501.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0111501.10 + phase: 0 /partial
(660 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c06431 66 1e-10
>KJC_c06431
Length = 432
Score = 65.9 bits (33), Expect = 1e-10
Identities = 69/81 (85%)
Strand = Plus / Minus
Query: 59 caactcgtgtcatgggaacttttgggtacttggctcctgagtatgcatctagtggcaagc 118
|||| ||||| |||||||| |||||||| ||||||||||||| ||| | |||||||||
Sbjct: 319 caacacgtgtgatgggaacctttgggtatatggctcctgagtacgcaacaagtggcaagt 260
Query: 119 ttactgagaaatctgacgttt 139
| ||||| |||||||| ||||
Sbjct: 259 tgactgaaaaatctgatgttt 239