Jatropha Genome Database

JcCB0104981.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0104981.10 - phase: 0 
         (1605 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c06975                                                             62   4e-09

>KJC_c06975 
          Length = 755

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 319 ccaaggcaaccttggcatgatttgcattgtaaaattgagggtccagctgcatatgatgt 377
           |||||| |||| ||||||||| ||||||||| |||||| || ||||| |||||||||||
Sbjct: 438 ccaagggaaccatggcatgatctgcattgtagaattgatgggccagcagcatatgatgt 380