Jatropha Genome Database

JcCB0099081.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0099081.10 + phase: 0 /partial
         (474 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c12386                                                             70   5e-12

>KJC_c12386 
          Length = 463

 Score = 69.9 bits (35), Expect = 5e-12
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 256 gtgggtagaaatgcagatgcacttgcactatattttggtgaggatccagctcgttgccca 315
           ||||||||||||||||||||| | || || |||||||| || || || ||||| ||||||
Sbjct: 104 gtgggtagaaatgcagatgcattggctctttattttggggaagaccctgctcgatgccca 163

                      
Query: 316 tttgagcaagt 326
           |||||||||||
Sbjct: 164 tttgagcaagt 174