Jatropha Genome Database

JcCB0097811.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0097811.10 + phase: 0 /partial
         (426 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c01226                                                             66   7e-11

>KJC_c01226 
          Length = 1481

 Score = 65.9 bits (33), Expect = 7e-11
 Identities = 43/45 (95%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                         
Query: 218  atttaacaggaggttactatga-tgctggtgataatgtaaaattt 261
            |||||||||||||||||||||| |||||| |||||||||||||||
Sbjct: 1336 atttaacaggaggttactatgattgctggagataatgtaaaattt 1292