Jatropha Genome Database
- JcCB0097811.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0097811.10 + phase: 0 /partial
(426 letters)
Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09
21,225 sequences; 12,776,988 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KJC_c01226 66 7e-11
>KJC_c01226
Length = 1481
Score = 65.9 bits (33), Expect = 7e-11
Identities = 43/45 (95%), Gaps = 1/45 (2%)
Strand = Plus / Minus
Query: 218 atttaacaggaggttactatga-tgctggtgataatgtaaaattt 261
|||||||||||||||||||||| |||||| |||||||||||||||
Sbjct: 1336 atttaacaggaggttactatgattgctggagataatgtaaaattt 1292