Jatropha Genome Database

JcCB0080851.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0080851.10 + phase: 0 /partial
         (468 letters)

Database: jatropha cDNA leaf/callus assembly
(MIRA3.0.5:c=standard,s=non-debris singleton) 2010/06/09 
           21,225 sequences; 12,776,988 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KJC_c10755                                                            331   9e-91

>KJC_c10755 
          Length = 469

 Score =  331 bits (167), Expect = 9e-91
 Identities = 170/171 (99%)
 Strand = Plus / Plus

                                                                       
Query: 298 ttggatctgttggttagattcattcaaaaccttttcaagaaggtatctaaacaagccagg 357
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38  ttggatctgttggttagattcattcaaaaccttttcaagaaggtatctaaacaagccagg 97

                                                                       
Query: 358 gaggcggtgcgatcggtcttgcctgtttctatctccaccaaactggtgactttttcagtg 417
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98  aaggcggtgcgatcggtcttgcctgtttctatctccaccaaactggtgactttttcagtg 157

                                                              
Query: 418 aatggagtcctagtgctggcatttttgtgggtattgaaggcattccttgag 468
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 158 aatggagtcctagtgctggcatttttgtgggtattgaaggcattccttgag 208